BBa_R2114 1 BBa_R2114 Promoter with operator site for C2003 2006-10-22T11:00:00Z 2015-05-08T01:14:16Z This part was inadvertently made while trying to make BBa_R2111. It contains a single base pair mutation in the -10 site of BBa_R2111. This promoter is designed to bind to C2003. false false _41_ 0 126 70 It's complicated false The placement of the operator site was designed to be near optimal for steric interference between C2003 and RNA polymerase. false Reshma Shetty annotation1904662 1 C2003 operator site range1904662 1 23 34 annotation1904659 1 -10 site range1904659 1 40 45 annotation1904660 1 -35 site range1904660 1 17 22 annotation1904661 1 transcription start site range1904661 1 53 53 BBa_R2114_sequence 1 tttatcaaaaagagtgttgactcccacgcgtgggaataggatatttagattcataaatttgagagaggagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z