BBa_R0182 1 BBa_R0182 T7 RNAP promoter 2005-09-25T11:00:00Z 2015-05-08T01:14:15Z T7 promoter with an A->T mutation at the -10 position of the consensus sequence false false _11_6_ 0 135 6 Not in stock false false Barry Canton BBa_R2182 1 BBa_R2182 RiPS generator 2005-11-08T12:00:00Z 2015-05-08T01:14:16Z a weak T7 promoter with an <I> E. coli </I> RBS downstream false false _11_6_ 0 135 6 Not in stock false false Barry Canton component1741561 1 BBa_B0032 component1741553 1 BBa_R0182 annotation1741561 1 BBa_B0032 range1741561 1 32 44 annotation1741553 1 BBa_R0182 range1741553 1 1 23 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_R2182_sequence 1 taatacgtctcactatagggagatactagagtcacacaggaaag BBa_B0032_sequence 1 tcacacaggaaag BBa_R0182_sequence 1 taatacgtctcactatagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z