BBa_B0037 1 BBa_B0037 Specialized RBS 2005-12-06T12:00:00Z 2015-08-31T04:07:20Z Brink MF, Verbeet MP, de Boer HA (1995). Specialized ribosomes: highly specific translation in vivo of a single targetted mRNA species. Gene, 156, pp. 215-222 RBS specific to dedicated ribosomes. This RBS is a modified version of B0036. The spacing between the SD sequence and the start codon has been increased by 5 bases to give the same spacing as used by Brink et al. The 5 bases are the same as those used by Brink. That means they form the first five bases of an XbaI site and no negative affects of using these bases are known at present. false false _11_6_ 0 135 6 Not in stock false false Barry Canton BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_R4037 1 BBa_R4037 Tet repressible promoter and dedicated RBS 2005-12-06T12:00:00Z 2015-05-08T01:14:16Z This composite part is composed of a tet repressible promoter and a dedicated RBS. It will be used to construct a reporter system for VM1.0. GFP production from the reporter system can be compared to the GFP production of a similar system that uses a T7 promoter instead of an <I>E. coli</I> promoter and to I7102 which uses a slightly different dedicated RBS. false false _11_6_ 0 135 6 Not in stock false false Barry Canton component1760605 1 BBa_R0040 component1760610 1 BBa_B0037 annotation1760605 1 BBa_R0040 range1760605 1 1 54 annotation1760610 1 BBa_B0037 range1760610 1 63 72 BBa_R4037_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagaggtgtgtctag BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0037_sequence 1 gtgtgtctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z