BBa_R0182 1 BBa_R0182 T7 RNAP promoter 2005-09-25T11:00:00Z 2015-05-08T01:14:15Z T7 promoter with an A->T mutation at the -10 position of the consensus sequence false false _11_6_ 0 135 6 Not in stock false false Barry Canton BBa_B0036 1 BBa_B0036 Specialized RBS 2004-06-07T11:00:00Z 2015-08-31T04:07:20Z Brink MF, Verbeet MP, de Boer HA (1995). Specialized ribosomes: highly specific translation in vivo of a single targetted mRNA species. Gene, 156, pp. 215-222 This RBS is recognized by ribosomes carrying the modified anti-Shine Dalgarno sequence as found in Brink et al. (see below) false false _11_6_ 0 135 7 Not in stock false false Barry Canton BBa_R6182 1 BBa_R6182 RiPS generator 2005-11-08T12:00:00Z 2015-05-08T01:14:16Z A weak T7 promoter with a dedicated ribosome binding site downstream false false _11_6_ 0 135 6 Not in stock false false Barry Canton component1741549 1 BBa_B0036 component1741547 1 BBa_R0182 annotation1741547 1 BBa_R0182 range1741547 1 1 23 annotation1741549 1 BBa_B0036 range1741549 1 32 36 BBa_B0036_sequence 1 gtgtg BBa_R6182_sequence 1 taatacgtctcactatagggagatactagaggtgtg BBa_R0182_sequence 1 taatacgtctcactatagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z