BBa_R0182 1 BBa_R0182 T7 RNAP promoter 2005-09-25T11:00:00Z 2015-05-08T01:14:15Z T7 promoter with an A->T mutation at the -10 position of the consensus sequence false false _11_6_ 0 135 6 Not in stock false false Barry Canton BBa_B0037 1 BBa_B0037 Specialized RBS 2005-12-06T12:00:00Z 2015-08-31T04:07:20Z Brink MF, Verbeet MP, de Boer HA (1995). Specialized ribosomes: highly specific translation in vivo of a single targetted mRNA species. Gene, 156, pp. 215-222 RBS specific to dedicated ribosomes. This RBS is a modified version of B0036. The spacing between the SD sequence and the start codon has been increased by 5 bases to give the same spacing as used by Brink et al. The 5 bases are the same as those used by Brink. That means they form the first five bases of an XbaI site and no negative affects of using these bases are known at present. false false _11_6_ 0 135 6 Not in stock false false Barry Canton BBa_R8237 1 BBa_R8237 Dedicated promoter and RBS 2005-12-06T12:00:00Z 2015-05-08T01:14:16Z This is a composite part of a T7 promoter and a dedicated RBS. It will be used to construct a reporter device for VM1.0 false false _11_6_ 0 135 6 Not in stock false false Barry Canton component1760586 1 BBa_B0037 component1760584 1 BBa_R0182 annotation1760584 1 BBa_R0182 range1760584 1 1 23 annotation1760586 1 BBa_B0037 range1760586 1 32 41 BBa_R8237_sequence 1 taatacgtctcactatagggagatactagaggtgtgtctag BBa_B0037_sequence 1 gtgtgtctag BBa_R0182_sequence 1 taatacgtctcactatagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z