BBa_S00159 1 BBa_S00159 R0011+B0100+B0048 2007-03-05T12:00:00Z 2015-05-08T01:14:16Z This part was generated by PCR amplification. The upstream biobricks cut sites (EcoRI and XbaI) as well as the R0011 promoter were incorporated into the forward promoter recognizing the ompA region in the MG1655 genome. The AvrII cut site, as well as the downstream biobricks cut sites (SpeI and PstI) were incorporated into the reverse promoter. This part is an intermediate assembly product that contains the R0011 promoter (lambda cI promoter with lacI binding sites), the OmpaA 5' UTR containing a double hairpin for transcript stability, and an AvrII restriction site to facilitate later downstream cloning of an RBS via Heather Keller's RBS characterization scheme. These parts are cloned bluntly, without generating biobricks mixed sites in between. false true _11_ 0 571 10 Not in stock false This part was generated by PCR assembly in order to minimize the number of digestions and ligations necessary to generate a larger construct. Especially given the short sequence of the three individual parts (and the difficulting in purifying small parts) it was much simpler to amplify the product in this way rather than generate the 3 parts individually and clone them together. false Heather Keller annotation1920204 1 BBa_B0100 range1920204 1 56 170 annotation1920197 1 -35 range1920197 1 20 25 annotation1920203 1 ss2 range1920203 1 159 170 annotation1920205 1 AvrII site range1920205 1 171 176 annotation1920201 1 ss1 range1920201 1 119 129 annotation1920206 1 BBa_B0048 range1920206 1 171 176 annotation1920198 1 lac O1 range1920198 1 26 42 annotation1920200 1 hp1 range1920200 1 56 118 annotation1920202 1 hp2 range1920202 1 130 158 annotation1920196 1 lac O1 range1920196 1 3 19 annotation1920195 1 BBa_R0011 range1920195 1 1 54 annotation1920199 1 -10 range1920199 1 43 48 BBa_S00159_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacagccaggggtgctcggcataagccgaagatatcggtagagttaatattgagcagatcccccggtgaaggatttaaccgtgttatctcgttggagatattcatggcgtattttggatcctagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z