BBa_B0100 1 OmpA 5 OmpA 5 2007-02-28T12:00:00Z 2015-08-31T04:07:21Z MG1655 genome, OmpA gene 5 prime UTR from the OmpA gene in E.coli used for stabilizing the downstream RNA transcript false false _11_ 0 571 10 Not in stock false This region was PCR amplified from the genome of MG1655. false Heather Keller annotation1919682 1 ss1 range1919682 1 64 74 annotation1919684 1 ss2 range1919684 1 104 115 annotation1919681 1 hp1 range1919681 1 1 63 annotation1919683 1 hp2 range1919683 1 75 103 BBa_S00163 1 BBa_S00163 R0011 + B0100 2007-03-06T12:00:00Z 2015-05-08T01:14:16Z n/a This is a theoretical intermediate part that will never be physically built, but is necessary for creating the part files of my RBS measurement devices which do not use Biobricks Cloning Sites for inserting the RBS sequence. This is the region found upstream of the RBS sequence in all of the GFP and mCherry measurement devices. A AvrII/XbaI scar site (part BBaB0104) is also created between this part and the RBS. false false _11_ 0 571 10 Not in stock false n/a false Heather Keller component1920689 1 BBa_B0100 component1920680 1 BBa_R0011 annotation1920680 1 BBa_R0011 range1920680 1 1 54 annotation1920689 1 BBa_B0100 range1920689 1 56 170 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2002 1 -10 range2002 1 43 48 annotation1999 1 lac O1 range1999 1 3 19 annotation2000 1 -35 range2000 1 20 25 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 BBa_B0100_sequence 1 gccaggggtgctcggcataagccgaagatatcggtagagttaatattgagcagatcccccggtgaaggatttaaccgtgttatctcgttggagatattcatggcgtattttggat BBa_S00163_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacagccaggggtgctcggcataagccgaagatatcggtagagttaatattgagcagatcccccggtgaaggatttaaccgtgttatctcgttggagatattcatggcgtattttggat BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z