BBa_S01002 1 BBa_S01002 R0071.E0422 2005-06-10T11:00:00Z 2015-05-08T01:14:16Z Released HQ 2013 Intermediate part from Jen 1 Tube 46 false false _1_ 0 25 1 In stock false false component1511051 1 BBa_B0010 component1511043 1 BBa_E0022 component1511026 1 BBa_R0071 component1511031 1 BBa_B0034 component1511061 1 BBa_B0012 annotation1511031 1 BBa_B0034 range1511031 1 62 73 annotation1511026 1 BBa_R0071 range1511026 1 1 53 annotation1511043 1 BBa_E0022 range1511043 1 80 841 annotation1511061 1 BBa_B0012 range1511061 1 938 978 annotation1511051 1 BBa_B0010 range1511051 1 850 929 BBa_E0022 1 ECFP enhanced cyan fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0021</bb_part>. Released HQ 2013 Cyan fluorescent protein (ECFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0022 cyan fluorescent protein is based on BioBrick part BBa_E0021. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2153 1 SsrA range2153 1 719 756 annotation2150 1 CFP (LVA) range2150 1 1 762 annotation2154 1 2 range2154 1 757 762 annotation7040 1 BBa_E0022 range7040 1 1 762 annotation2155 1 A range2155 1 69 69 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_R0071 1 RhlR+C4 Promoter (RhlR & C4-HSL regulated) 2004-01-24T12:00:00Z 2015-05-08T01:14:15Z <i>Pseudomonas aeruginosa</i> rhlAB promoter Released HQ 2013 Promoter activated by RhlR in concert with C4-HSL. C4-HSL is produced by RhlI, and acts as a quorum-sensing autoinducer. <p> This is the natural sequence taken from Pseudomonas aeruginosa. <p> Crosstalk: this promoter is also activated at a low level by LasR with its associated HSL. false false _1_ 0 24 7 In stock false The -10 and -35 sites are labeled as identified in [Pearson97]. <P> The part begins with the RhlR binding site, and (rather arbitrarily) ends with the first transcribed base (+1). true Ronny Krashinsky annotation297104 1 -10 range297104 1 42 47 annotation297102 1 RhlR range297102 1 1 20 annotation297105 1 start range297105 1 53 53 annotation297103 1 -35 range297103 1 19 24 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0071_sequence 1 tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttc BBa_B0034_sequence 1 aaagaggagaaa BBa_E0022_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_S01002_sequence 1 tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttctactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z