BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_C0050 1 cI HK022 cI repressor from phage HK022 (+LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage HK022. Released HQ 2013 Coding region for the HK022 bacteriophage cI protein. cI binds to the HK022 pR regulator (BBa_R0050). It represses transcription of the protein encoded by the sequence 3' to the pR region. This coding sequence does not contain a RBS.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Carlson NG, Little JW. Highly cooperative DNA binding by the coliphage HK022 repressor. J Mol Biol. 1993 Apr 20;230(4):1108-30.<br> PMID: 8487297.</P> <P> Mao C, Little JW. Mutations affecting cooperative DNA binding of phage HK022 CI repressor.<br> J Mol Biol. 1998 May 29;279(1):31-48. PMID: 9636698.</P> <p></p> <p></p> <P> References (unparsed) here: <p>Carlson NG, Little JW. Highly cooperative DNA binding by the coliphage HK022 repressor. J Mol Biol. 1993 Apr 20;230(4):1108-30.<br> PMID: 8487297.</P> <P> Mao C, Little JW. Mutations affecting cooperative DNA binding of phage HK022 CI repressor.<br> J Mol Biol. 1998 May 29;279(1):31-48. PMID: 9636698.</P> <p></p> <p></p> <P>Derived from <genbank>STHK022N</genbank>.<br> <br> Response from John Little (Arizona) regarding the start of HK022 cI<br> <br> From: <jlittle@email.arizona.edu> <br> Date: Tue Jan 21, 2003 4:39:21 PM US/Eastern <br> To: "Drew Endy" <endy@MIT.EDU><br> Subject: RE: hk022 cI start (naive question)? <br> Hello Drew and Michael, I seriously doubt that the extra 27 aa are part of CI. It doesn't make sense in terms of the biology, for sure. In any case, the protein we characterized starts where Carlson and Little stated; as I recall, oR3 partially overlaps the start of cI. I have a vague memory of some possibly interesting biology, having to do with multicopy plasmids. I don't recall the findings themselves. Anyway, one possible explanation was that this extra N-terminal addition was made (e.g. from the pRE promoter, or from a message that arose from transcription around the entire plasmid), making a protein with altered functions. We never followed it up. <br> Good luck <br> John<br> <br> -- Original Message -- <br> Date: Sun, 19 Jan 2003 15:26:26 -0500 <br> Subject: hk022 cI start (naive question)? <br> Cc: elowitm@rockefeller.edu <br> To: jlittle@u.arizona.edu <br> From: Drew Endy <endy@MIT.EDU> <br> Hi John, I'm sitting here with Michael Elowitz and we're working through the sequence for HK022 cI. We noticed that the annotation from NC_002166 includes an "extra" 81 base pairs upstream of what we thought of as the actual start. It looks like this extra DNA extends into the PR regulatory region. We're wondering what's going on here? I'm guessing this is well documented somewhere. Thanks for any pointers/info! <br> Drew<P> It is unknown whether there is cross-talk between this repressor and Lambda cI regulatory region, 434 cI regulatory region and P22 regulatory region. true Reshma Shetty annotation1737 1 OR3 partial range1737 1 1 8 annotation1735 1 cI HK022 range1735 1 1 744 annotation2213990 1 Help:Barcodes range2213990 1 745 769 annotation1734 1 2 range1734 1 739 744 annotation7033 1 BBa_C0050 range7033 1 1 744 annotation1736 1 SsrA range1736 1 706 738 BBa_S0114 1 BBa_S0114 B0031.C0050 2003-12-04T12:00:00Z 2015-05-08T01:14:17Z false false _1_ 0 24 7 It's complicated false false Caitlin Conboy and Jennifer Braff component939954 1 BBa_C0050 component939939 1 BBa_B0031 annotation939939 1 BBa_B0031 range939939 1 1 14 annotation939954 1 BBa_C0050 range939954 1 21 764 BBa_B0031_sequence 1 tcacacaggaaacc BBa_S0114_sequence 1 tcacacaggaaacctactagatggttcaacagaaagagcgtgaaactttctcgcagaggcttgcgctggcctgtgataaagcgggattacctttgcatggtaggcaggctgatttagctgtcaggcttaaggtcacaccaaaagccattagtaaatggttcaacggggagtcaataccaagaaaagacaagatggaatctctggcttcggtgctgggaactactgctgcatatctgcatggctatgctgatgatgacggtatcacggtaaatcatctatcaagatcaaatgattattatcgtgttgatgtattggatgttcaggcgagcgccgggccaggaaccatggtttccaatgaatttatagaaaagataagagcaattgaatatacgaccgagcaggcaagaattttatttaatggaaggccacaggaaagcgtaaaagtcatcacggttcgcggtgacagcatggagggaaccatcaatccgggagatgagatctttgttgatgtatccataacctgttttgatggcgatggcatttatgtgtttgtatacgggaaaacaatgcacgttaagcgcctgcaaatgcaaaagaacaggcttgccgtcatctctgacaatgccgcttatgatcgatggtacatagaagaaggtgaagaagagcaacttcacattctagccaaagtcctcattaggcagtcaatcgattacaagcgattcggagctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc BBa_C0050_sequence 1 atggttcaacagaaagagcgtgaaactttctcgcagaggcttgcgctggcctgtgataaagcgggattacctttgcatggtaggcaggctgatttagctgtcaggcttaaggtcacaccaaaagccattagtaaatggttcaacggggagtcaataccaagaaaagacaagatggaatctctggcttcggtgctgggaactactgctgcatatctgcatggctatgctgatgatgacggtatcacggtaaatcatctatcaagatcaaatgattattatcgtgttgatgtattggatgttcaggcgagcgccgggccaggaaccatggtttccaatgaatttatagaaaagataagagcaattgaatatacgaccgagcaggcaagaattttatttaatggaaggccacaggaaagcgtaaaagtcatcacggttcgcggtgacagcatggagggaaccatcaatccgggagatgagatctttgttgatgtatccataacctgttttgatggcgatggcatttatgtgtttgtatacgggaaaacaatgcacgttaagcgcctgcaaatgcaaaagaacaggcttgccgtcatctctgacaatgccgcttatgatcgatggtacatagaagaaggtgaagaagagcaacttcacattctagccaaagtcctcattaggcagtcaatcgattacaagcgattcggagctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z