BBa_C0052 1 cI 434 cI repressor from phage 434 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage 434 Released HQ 2013 The 434 cI repressor protein coding sequence is a 710 base-pair sequence with the standard RBS-compatible BioBrick prefix and the standard BioBrick suffix sections on its ends. It binds to the 434 regulatory sequence, BBa_R0052. The sequence contains a LVA tag for faster degredation and has no RBS.</p> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Nikolnikov,S., Posfai,G. and Sain,B. <em>The construction of a versatile plasmid vector that allows direct<br> selection of fragments cloned into six unique sites of the cI gene of coliphage 434</em>. Gene 30 (1-3), 261-265 (1984)<P> References (unparsed) here: <p>Nikolnikov,S., Posfai,G. and Sain,B. <em>The construction of a versatile plasmid vector that allows direct<br> selection of fragments cloned into six unique sites of the cI gene of coliphage 434</em>. Gene 30 (1-3), 261-265 (1984)<P><P> true Maia Mahoney annotation1743 1 cI 434 range1743 1 1 669 annotation2213992 1 Help:Barcodes range2213992 1 670 694 annotation7035 1 BBa_C0052 range7035 1 1 669 annotation1745 1 LVA range1745 1 631 669 BBa_S0116 1 BBa_S0116 B0031.C0052 2003-12-04T12:00:00Z 2015-05-08T01:14:17Z Released HQ 2013 false false _1_ 0 24 7 In stock false false Caitlin Conboy and Jennifer Braff component939974 1 BBa_B0031 component939984 1 BBa_C0052 annotation939984 1 BBa_C0052 range939984 1 21 689 annotation939974 1 BBa_B0031 range939974 1 1 14 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_S0116_sequence 1 tcacacaggaaacctactagatgagtatttcttccagggtaaaaagcaaaagaatccagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagcttgtgaaccctacgatatcaaggacattgatgaatggtatgacagtgacgttaacttattaggcaatggattctggctgaaggttgaaggtgattccatgacctcacctgtaggtcaaagcatccctgaaggtcatatggtgttagtagatactggacgggagccagtgaatggaagccttgttgtagccaaactgactgacgcgaacgaagcaacattcaagaaactggtcatagatggcggtcagaagtacctgaaaggcctgaatccttcatggcctatgactcctatcaacggaaactgcaagattatcggtgttgtcgtggaagcgagggtaaaattcgtagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0031_sequence 1 tcacacaggaaacc BBa_C0052_sequence 1 atgagtatttcttccagggtaaaaagcaaaagaatccagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagcttgtgaaccctacgatatcaaggacattgatgaatggtatgacagtgacgttaacttattaggcaatggattctggctgaaggttgaaggtgattccatgacctcacctgtaggtcaaagcatccctgaaggtcatatggtgttagtagatactggacgggagccagtgaatggaagccttgttgtagccaaactgactgacgcgaacgaagcaacattcaagaaactggtcatagatggcggtcagaagtacctgaaaggcctgaatccttcatggcctatgactcctatcaacggaaactgcaagattatcggtgttgtcgtggaagcgagggtaaaattcgtagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z