BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_C0061 1 luxI autoinducer synthetase for AHL 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 Synthesizes 3OC₆HSL, which binds to LuxR.</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound HSL. This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false false _1_ 0 24 7 In stock false <P> <P>An LVA tail (sequence: AANDENYALVA) was added to increase protein degradation. . <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7038 1 BBa_C0061 range7038 1 1 618 annotation1760 1 LVA range1760 1 580 611 annotation2213985 1 Help:Barcodes range2213985 1 619 643 annotation1761 1 luxI range1761 1 1 579 BBa_S01372 1 BBa_S01372 Intermediate part from assembly 239 2003-12-04T12:00:00Z 2015-05-08T01:14:17Z true false _1_ 0 24 7 Discontinued false false Caitlin Conboy component954203 1 BBa_C0061 component954210 1 BBa_B0010 component954220 1 BBa_B0012 component954237 1 BBa_R0063 component954193 1 BBa_B0034 annotation954220 1 BBa_B0012 range954220 1 758 798 annotation954193 1 BBa_B0034 range954193 1 1 12 annotation954237 1 BBa_R0063 range954237 1 807 957 annotation954210 1 BBa_B0010 range954210 1 670 749 annotation954203 1 BBa_C0061 range954203 1 19 636 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_R0063 1 lux pL Promoter (luxR & HSL regulated -- lux pL)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri.</em> Released HQ 2013 The lux cassette of V. fischeri contains a left and a right promoter. The left promoter gives weak constitutive expression of downstream genes.This expression is down-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription from Pr, repressing transcription from Pl</p> false true _1_ 0 24 7 In stock false <P> <P> This promoter is based on the Vibrio fischeri quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below.Includes most of Lux reulatory region, including the LuxR binding site which activates the right promoter. A putative LuxR autorepression binding site is also identified adjacent to the -10 site of the right promoter. This 2nd site has 55% identity with the first site. Putative inverted repeats (of size 18-27 bp) also exist between these two sites (not marked above), which may represent binding sites for other regulatory proteins. <p><img src="<bb_file>Image01.gif</bb_file>" width="614" height="362"><P>Unspecified. true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7071 1 BBa_R0063 range7071 1 1 151 annotation2054 1 start range2054 1 128 128 annotation2052 1 -10 range2052 1 115 122 annotation2055 1 Putative LuxR/HSL range2055 1 130 149 annotation2053 1 -35 range2053 1 89 94 annotation2051 1 LuxR/HSL range2051 1 1 20 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0063_sequence 1 acctgtacgatcctacaggtgcttatgttaagtaattgtattcccagcgatacaatagtgtgacaaaaatccaatttattagaatcaaatgtcaatccattaccgttttaatgatatataacacgcaaaacttgcgacaaacaataggtaa BBa_C0061_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0034_sequence 1 aaagaggagaaa BBa_S01372_sequence 1 aaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacctgtacgatcctacaggtgcttatgttaagtaattgtattcccagcgatacaatagtgtgacaaaaatccaatttattagaatcaaatgtcaatccattaccgttttaatgatatataacacgcaaaacttgcgacaaacaataggtaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z