BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_S03260 1 BBa_S03260 Intermediate part from assembly 317 2004-08-15T11:00:00Z 2015-05-08T01:14:20Z false false _11_1_ 0 60 7 Not in stock false false cconboy component2219220 1 BBa_B0015 component2219213 1 BBa_C0020 annotation2219220 1 BBa_B0015 range2219220 1 402 530 annotation2219213 1 BBa_C0020 range2219213 1 1 393 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_C0020 1 cheY CheY "tumbling" chemotaxis coding sequence 2004-08-01T11:00:00Z 2015-08-31T04:07:23Z NCBI - Escherichia coli K12 MG1655 (NC_000913) This part codes for CheY, a protein used by E. coli for chemotaxis. Increased concentrations of CheY has been shown to make E. coli tumble more. false true _6_ 0 101 7 It's complicated false Changes from the NCBI sequence: A BioBricks restriction site for PstI was at position 260. As a result, the codon starting at position 262 was changed from "gca" to "gcg". <p> The terminating codon at the end, "tga", was changed to "taataa" as per BioBrick regulations as told to us by Randy Rettberg. false Victoria Chou, Kenneth Nesmith, Madeleine Sheldon-Dante annotation1891581 1 cheY range1891581 1 1 393 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S03260_sequence 1 atggcggataaagaacttaaatttttggttgtggatgacttttccaccatgcgacgcatagtgcgtaacctgctgaaagagctgggattcaataatgttgaggaagcggaagatggcgtcgacgctctcaataagttgcaggcaggcggttatggatttgttatctccgactggaacatgcccaatatggatggcctggaattgctgaaaacaattcgtgcggatggcgcgatgtcggcattgccagtgttaatggtgactgcggaagcgaagaaagagaacatcattgctgcggcgcaagcgggggccagtggctatgtggtgaagccatttaccgccgcgacgctggaggaaaaactcaacaaaatctttgagaaactgggcatgtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0020_sequence 1 atggcggataaagaacttaaatttttggttgtggatgacttttccaccatgcgacgcatagtgcgtaacctgctgaaagagctgggattcaataatgttgaggaagcggaagatggcgtcgacgctctcaataagttgcaggcaggcggttatggatttgttatctccgactggaacatgcccaatatggatggcctggaattgctgaaaacaattcgtgcggatggcgcgatgtcggcattgccagtgttaatggtgactgcggaagcgaagaaagagaacatcattgctgcggcgcaagcgggggccagtggctatgtggtgaagccatttaccgccgcgacgctggaggaaaaactcaacaaaatctttgagaaactgggcatgtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z