BBa_S03309 1 BBa_S03309 R0011.I1032 2005-08-22T11:00:00Z 2015-05-08T01:14:21Z Assembly for part J07039 by Lucy and Randy 8-05 false false _42_1_ 0 25 1 Not in stock false false Randy Rettberg component1667787 1 BBa_I1032 component1667771 1 BBa_R0011 annotation1667771 1 BBa_R0011 range1667771 1 1 54 annotation1667787 1 BBa_I1032 range1667787 1 64 318 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2001 1 lac O1 range2001 1 26 42 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation1999 1 lac O1 range1999 1 3 19 annotation2000 1 -35 range2000 1 20 25 annotation2002 1 -10 range2002 1 43 48 BBa_I1032 1 BBa_I1032 CI(1) &quot;micRNA&quot; asRNA 2003-01-31T12:00:00Z 2015-08-31T04:07:29Z see references Region which serves as basis for transcription of asRNA that binds to and inhibits <bb_part>BBa_I1030</bb_part>'s mRNA transcript. Has LacO-1 regulatory region and a Promoter. Part of the XOR gate comprised of <bb_part>BBa_I1030</bb_part> and <bb_part>BBa_I1040</bb_part>, their corresponding asRNA coding sequences (<bb_part>BBa_I1012</bb_part> and <bb_part>BBa_I1032</bb_part>). false false _1_ 0 24 7 It's complicated false <P> <P>Complementary to beginning of <bb_part>BBa_I1030</bb_part> transcript covering junk region, RBS, start codon, and 73 bp into coding sequence. Two stem loops flank the antisense region. [<A href="http://biobricks.ai.mit.edu/BB_References.htm#KEIL96">KEIL96</A>] <P> Incompatible with systems containing <bb_part>BBa_I1031</bb_part> <br>Compatible with <bb_part>BBa_I1020</bb_part>, <bb_part>BBa_I1021</bb_part>, <bb_part>BBa_I1022</bb_part>, <bb_part>BBa_I1023</bb_part>. true Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation1891 1 LacO-1 range1891 1 1 55 annotation1888 1 antisense region for I1030 range1888 1 113 220 annotation1890 1 stem_loop range1890 1 221 255 annotation7052 1 BBa_I1032 range7052 1 1 255 annotation1889 1 stem_loop range1889 1 56 112 BBa_I1032_sequence 1 ataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcactaaaatcaataacttattcttaagtatttgacagcactgaatgtcaaaacaaaacctttcataaattgctttaaggcgacgtgcgtcctcaagctgctcttgtgttaatggtttcttttttgtcgacatcgaaccggtttcctgtcgttgctgttgtgcaaagcttatttcaaccggatgcctggcattcggtttttttt BBa_S03309_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcactaaaatcaataacttattcttaagtatttgacagcactgaatgtcaaaacaaaacctttcataaattgctttaaggcgacgtgcgtcctcaagctgctcttgtgttaatggtttcttttttgtcgacatcgaaccggtttcctgtcgttgctgttgtgcaaagcttatttcaaccggatgcctggcattcggtttttttt BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z