BBa_S03310 1 BBa_S03310 I1032.B0015 2005-08-22T11:00:00Z 2015-05-08T01:14:21Z Assembly for part J07039 by Lucy and Randy 8-05 false false _42_1_ 0 25 1 Not in stock false false Randy Rettberg component1667808 1 BBa_B0010 component1667818 1 BBa_B0012 component1667800 1 BBa_I1032 annotation1667818 1 BBa_B0012 range1667818 1 352 392 annotation1667800 1 BBa_I1032 range1667800 1 1 255 annotation1667808 1 BBa_B0010 range1667808 1 264 343 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_I1032 1 BBa_I1032 CI(1) &quot;micRNA&quot; asRNA 2003-01-31T12:00:00Z 2015-08-31T04:07:29Z see references Region which serves as basis for transcription of asRNA that binds to and inhibits <bb_part>BBa_I1030</bb_part>'s mRNA transcript. Has LacO-1 regulatory region and a Promoter. Part of the XOR gate comprised of <bb_part>BBa_I1030</bb_part> and <bb_part>BBa_I1040</bb_part>, their corresponding asRNA coding sequences (<bb_part>BBa_I1012</bb_part> and <bb_part>BBa_I1032</bb_part>). false false _1_ 0 24 7 It's complicated false <P> <P>Complementary to beginning of <bb_part>BBa_I1030</bb_part> transcript covering junk region, RBS, start codon, and 73 bp into coding sequence. Two stem loops flank the antisense region. [<A href="http://biobricks.ai.mit.edu/BB_References.htm#KEIL96">KEIL96</A>] <P> Incompatible with systems containing <bb_part>BBa_I1031</bb_part> <br>Compatible with <bb_part>BBa_I1020</bb_part>, <bb_part>BBa_I1021</bb_part>, <bb_part>BBa_I1022</bb_part>, <bb_part>BBa_I1023</bb_part>. true Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation1889 1 stem_loop range1889 1 56 112 annotation1890 1 stem_loop range1890 1 221 255 annotation1891 1 LacO-1 range1891 1 1 55 annotation7052 1 BBa_I1032 range7052 1 1 255 annotation1888 1 antisense region for I1030 range1888 1 113 220 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I1032_sequence 1 ataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcactaaaatcaataacttattcttaagtatttgacagcactgaatgtcaaaacaaaacctttcataaattgctttaaggcgacgtgcgtcctcaagctgctcttgtgttaatggtttcttttttgtcgacatcgaaccggtttcctgtcgttgctgttgtgcaaagcttatttcaaccggatgcctggcattcggtttttttt BBa_S03310_sequence 1 ataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcactaaaatcaataacttattcttaagtatttgacagcactgaatgtcaaaacaaaacctttcataaattgctttaaggcgacgtgcgtcctcaagctgctcttgtgttaatggtttcttttttgtcgacatcgaaccggtttcctgtcgttgctgttgtgcaaagcttatttcaaccggatgcctggcattcggtttttttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z