BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2002 1 -10 range2002 1 43 48 annotation1999 1 lac O1 range1999 1 3 19 annotation2000 1 -35 range2000 1 20 25 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 BBa_S03325 1 BBa_S03325 --Specify Parts List-- 2005-08-23T11:00:00Z 2015-05-08T01:14:21Z R0011.I13032 false false _41_ 0 386 41 Not in stock false false Lucy Zhang component1668700 1 BBa_B0010 component1668710 1 BBa_B0012 component1668730 1 BBa_R0075 component1668691 1 BBa_R0011 annotation1668691 1 BBa_R0011 range1668691 1 1 54 annotation1668700 1 BBa_B0010 range1668700 1 64 143 annotation1668730 1 BBa_R0075 range1668730 1 201 317 annotation1668710 1 BBa_B0012 range1668710 1 152 192 BBa_R0075 1 cI TP901 Promoter (TP901 cI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z TP901-1 cI repressor from phage TP901 infecting L. lactis false false _1_ 0 24 7 It's complicated false operator sites: pR and pL false crackdots annotation302714 1 cI tp901 OR range302714 1 19 57 annotation320591 1 start range320591 1 89 89 annotation319983 1 -35 range319983 1 53 59 annotation319984 1 cI tp901 OL range319984 1 85 115 annotation319985 1 -10 range319985 1 76 82 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0075_sequence 1 cgcatcttgaacaaaagttcaacaaaaaaattcatatttcgtgaacttttttgttgacaaagataaaaacacatgatatactaatttcataaagttcatgaaacgtgaactgaaatt BBa_S03325_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagcgcatcttgaacaaaagttcaacaaaaaaattcatatttcgtgaacttttttgttgacaaagataaaaacacatgatatactaatttcataaagttcatgaaacgtgaactgaaatt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z