BBa_S03326 1 BBa_S03326 I13032.B0015 2005-08-23T11:00:00Z 2015-05-08T01:14:21Z I13032.B0015 false false _41_ 0 386 41 Not in stock false false Lucy Zhang component1668771 1 BBa_B0010 component1668766 1 BBa_R0075 component1668746 1 BBa_B0012 component1668736 1 BBa_B0010 component1668781 1 BBa_B0012 annotation1668771 1 BBa_B0010 range1668771 1 263 342 annotation1668746 1 BBa_B0012 range1668746 1 89 129 annotation1668781 1 BBa_B0012 range1668781 1 351 391 annotation1668766 1 BBa_R0075 range1668766 1 138 254 annotation1668736 1 BBa_B0010 range1668736 1 1 80 BBa_R0075 1 cI TP901 Promoter (TP901 cI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z TP901-1 cI repressor from phage TP901 infecting L. lactis false false _1_ 0 24 7 It's complicated false operator sites: pR and pL false crackdots annotation320591 1 start range320591 1 89 89 annotation319985 1 -10 range319985 1 76 82 annotation302714 1 cI tp901 OR range302714 1 19 57 annotation319983 1 -35 range319983 1 53 59 annotation319984 1 cI tp901 OL range319984 1 85 115 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S03326_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagcgcatcttgaacaaaagttcaacaaaaaaattcatatttcgtgaacttttttgttgacaaagataaaaacacatgatatactaatttcataaagttcatgaaacgtgaactgaaatttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0075_sequence 1 cgcatcttgaacaaaagttcaacaaaaaaattcatatttcgtgaacttttttgttgacaaagataaaaacacatgatatactaatttcataaagttcatgaaacgtgaactgaaatt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z