BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_I12007 1 Prm + Modified lambda Prm promoter (OR-3 obliterated) 2004-07-14T11:00:00Z 2015-08-31T04:07:31Z Shih and Gussin (1983) Released HQ 2013 Lambda Prm promoter modified to be activated but not repressed by the lambda repressor (cI) false true _3_ 0 103 7 In stock false In wild type lambda phage, the OR3 site (-27 to -11) reads "tatcccttgcggtgata" on the sense strand of DNA. To prevent lambda repressor (cI) from binding to this site, the 4th through 10th nt of OR3 were replaced by the 7 nt between OR2 and OR1, "aaatagt" (-57 to -51), which in effect mutates 5 nt of the promoter. These nt were chosen to be about halfway between the -10 and -35 boxes of the promoter. Furthermore, since these nt already act as a spacer in wild-type phage, it is hoped they will not create undesired interactions. true Hans annotation937702 1 OR2 range937702 1 33 49 annotation937703 1 -35 range937703 1 48 53 annotation937704 1 mutate to obliterate OR3 range937704 1 59 65 annotation937705 1 -10 range937705 1 71 76 annotation937701 1 OR1 range937701 1 9 25 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_S03336 1 Prm+GFP Prm+ with GFP as a reporter 2005-09-20T11:00:00Z 2015-05-08T01:14:21Z Registry 7.05 Released HQ 2013 Prm+ promoter of the lambda-system (with OR3 region deactivated over mutation) with a GFP reporter. The purpose is to roughly quantify its relative basal activity compared with the constitutive activity of the Pr promoter. false true _34_ 0 398 34 In stock false For more details see <a href="http://parts2.mit.edu/wiki/index.php/ETH_Zurich#Event_Processing_Device_.28EPD.29">Sensing Device and Event Processing Device</a> documentation. false ETH Zurich iGEM Team 2005 component1700292 1 BBa_I12007 component1700314 1 BBa_B0012 component1700304 1 BBa_B0010 component1700297 1 BBa_B0034 component1700299 1 BBa_E0040 annotation1700304 1 BBa_B0010 range1700304 1 837 916 annotation1700314 1 BBa_B0012 range1700314 1 925 965 annotation1700292 1 BBa_I12007 range1700292 1 1 82 annotation1700297 1 BBa_B0034 range1700297 1 91 102 annotation1700299 1 BBa_E0040 range1700299 1 109 828 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I12007_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt BBa_B0034_sequence 1 aaagaggagaaa BBa_S03336_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgttactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z