BBa_S03383 1 BBa_S03383 Hix Left Site 2005-11-03T12:00:00Z 2015-05-08T01:14:22Z Hix Left Site, recognised by Hin Recombinase to cause sequence reversal of what lies between it and the Hix Right Site. false false _15_ 0 376 15 Not in stock false false Chris Field BBa_S03383_sequence 1 ttcttgaaaaccaaggtttttgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z