BBa_S03406 1 BBa_S03406 --Specify Parts List-- 2005-12-06T12:00:00Z 2015-05-08T01:14:22Z false false _9_ 0 516 9 Not in stock false false Taha Sutarwala annotation1760519 1 CDS 1 range1760519 1 37 45 annotation1760517 1 RBS 1 range1760517 1 17 20 annotation1760518 1 Loop 1 range1760518 1 25 35 annotation1760522 1 stop range1760522 1 71 71 annotation1760521 1 Promoter 2 range1760521 1 59 70 annotation1760512 1 promoter 1 range1760512 1 4 7 annotation1760516 1 operon 1 range1760516 1 8 15 annotation1760520 1 Mutation 1 range1760520 1 48 57 BBa_S03406_sequence 1 ccaaggttactggtcaatgcgctacgtaatgcggatgatcatgacatgacagtcagtccccgggtagacgtcaacgtgtcacacatgtgtcacactgtgtgtgtgtgtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z