BBa_S03513 1 BBa_S03513 J3101:B0015 2006-07-20T11:00:00Z 2015-05-08T01:14:24Z true false _61_ 0 919 61 Discontinued false false Sabriya Rosemond component1886298 1 BBa_J3101 component1886299 1 BBa_B0010 component1886301 1 BBa_B0012 annotation1886299 1 BBa_B0010 range1886299 1 86 165 annotation1886298 1 BBa_J3101 range1886298 1 1 77 annotation1886301 1 BBa_B0012 range1886301 1 174 214 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J3101 1 RE Recombinational Enhancer (RE) for Hin/Hix inverting 2006-06-01T11:00:00Z 2015-08-31T04:08:45Z false false _61_ 0 918 61 In stock true true Erin Zwack, Sabriya Rosemond annotation1884989 1 Originally a C range1884989 1 29 29 annotation1884992 1 Distal Fis Binding Site range1884992 1 55 69 annotation1880472 1 Mutation of SpeI site range1880472 1 51 51 annotation1884991 1 Proximal Fis Binding Site range1884991 1 6 21 annotation1884990 1 Insertion right before biobrick ends range1884990 1 77 77 annotation1884988 1 RE Sequence range1884988 1 1 77 annotation1880471 1 Former SpeI site range1880471 1 51 56 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S03513_sequence 1 ttcgggtgtcaacaattgaccaaaatattgatttacagcgtaatgcgctttctagtgcaaattgtgaccgcattttgtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J3101_sequence 1 ttcgggtgtcaacaattgaccaaaatattgatttacagcgtaatgcgctttctagtgcaaattgtgaccgcattttg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z