BBa_J52001 1 BBa_J52001 rluc 2006-08-03T11:00:00Z 2015-08-31T03:54:04Z none renilla luciferase true false _80_ 0 800 80 Discontinued false none false Monika Ciglic annotation1893566 1 start range1893566 1 1 10 BBa_J52007 1 BBa_J52007 PEST seqence 2006-08-03T11:00:00Z 2015-08-31T03:54:04Z genomic PEST seqence for degradation of proteins in mamalian cells true false _80_ 0 855 80 Discontinued false no false Jelka Pohar annotation1893577 1 pest range1893577 1 1 20 BBa_S03538 1 BBa_S03538 J52001:J52007 2006-08-03T11:00:00Z 2015-05-08T01:14:24Z true false _80_ 0 852 80 Discontinued false false Jernej Kovač component1893575 1 BBa_J52007 component1893574 1 BBa_J52001 annotation1893575 1 BBa_J52007 range1893575 1 39 109 annotation1893574 1 BBa_J52001 range1893574 1 1 30 BBa_S03538_sequence 1 atgatgcatgctagctagctagctagttaatactagagtgacttgctagcggtactgttagtcagtcgtatcatcgtacgttgggatcgtagctagtcggttaagtcga BBa_J52001_sequence 1 atgatgcatgctagctagctagctagttaa BBa_J52007_sequence 1 tgacttgctagcggtactgttagtcagtcgtatcatcgtacgttgggatcgtagctagtcggttaagtcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z