BBa_R0080 1 AraC Promoter (AraC regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z GenBank: J01641 (www.ncbi.nlm.nih.gov) Released HQ 2013 AraC operator, truncated to include araO1, araI1, araI2, c-amp1, and c-amp2 sites. This operator should *activate* transcription in the presence of AraC; b/c the operator lacks the araO2 site, there should not be araC-mediated repression. false false _1_ 0 24 7 In stock false true Sara Neves (Fighting Darwins) annotation301457 1 araO1 range301457 1 6 44 annotation301462 1 ara1 and ara2 range301462 1 73 101 annotation301456 1 c-amp2 range301456 1 4 29 annotation308601 1 -35 range308601 1 113 118 annotation301458 1 c-amp1 range301458 1 43 72 annotation308602 1 -10 range308602 1 136 141 BBa_S03549 1 BBa_S03549 R0081:R0080 2006-08-13T11:00:00Z 2015-05-08T01:14:24Z false true _57_ 0 1072 57 It's complicated false false Kaj Bernhardt component1895847 1 BBa_R0081 component1895854 1 BBa_R0080 annotation1895847 1 BBa_R0081 range1895847 1 1 183 annotation1895854 1 BBa_R0080 range1895854 1 192 340 BBa_R0081 1 AraC O2 Inhibitor (AraC loop attachment with O2 site) 2004-01-29T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 this piece of DNA contains a "dead" part of coding region for AraC, and a functional Operator2 site. when attached to the rest of the promoter region, this part allows for the binding and loop formation that would result in repression of the araC promoter false false _1_ 0 24 7 In stock false 1) changed ATG start codon to TAG stop 2) 6 random deletions upstream of putative araC binding sites to preserve spacing for loop back (BB ends will add 6 base pairs); spacing crucial in matching up O2 and I2 binding sites (turns of DNA helix) 3) designed to attach to R0080 to enable all (positive and negative) regulatory functions, and to form "loop back" true Sara Neves (Fighting Darwins) annotation331787 1 stem_loop range331787 1 57 72 annotation331785 1 defunct araC range331785 1 1 78 annotation331786 1 stem_loop range331786 1 22 37 BBa_R0081_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaac BBa_S03549_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaactactagaggcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccat BBa_R0080_sequence 1 gcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z