##gff-version 3 ##sequence-region BBa_S03516 1 214 ##sequence-region BBa_S03568 1 214 BBa_S03516 . terminator 1 80 . + 0 ID=BBa_B0010;Name=BBa_B0010 BBa_S03516 . stem_loop 12 55 . + 0 ID=annotation4184;Name=stem_loop;Parent=BBa_B0010 BBa_S03516 . engineered_region 1 80 . + 0 ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010 BBa_S03516 . sequence_feature 138 214 . + 0 ID=BBa_J3101;Name=BBa_J3101 BBa_S03516 . non_covalent_binding_site 192 206 . + 0 ID=annotation1884992;Name=Distal Fis Binding Site;Parent=BBa_J3101 BBa_S03516 . sequence_feature 138 214 . + 0 ID=annotation1884988;Name=RE Sequence;Parent=BBa_J3101 BBa_S03516 . sequence_feature 188 193 . + 0 ID=annotation1880471;Name=Former SpeI site;Parent=BBa_J3101 BBa_S03516 . sequence_feature 214 214 . + 0 ID=annotation1884990;Name=Insertion right before biobrick ends;Parent=BBa_J3101 BBa_S03516 . sequence_feature 166 166 . + 0 ID=annotation1884989;Name=Originally a C;Parent=BBa_J3101 BBa_S03516 . non_covalent_binding_site 143 158 . + 0 ID=annotation1884991;Name=Proximal Fis Binding Site;Parent=BBa_J3101 BBa_S03516 . sequence_feature 188 188 . + 0 ID=annotation1880472;Name=Mutation of SpeI site;Parent=BBa_J3101 BBa_S03516 . terminator 89 129 . + 0 ID=BBa_B0012;Name=BBa_B0012 BBa_S03516 . stop_codon 122 122 . + 0 ID=annotation1687;Name=stop;Parent=BBa_B0012 BBa_S03516 . engineered_region 89 129 . + 0 ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012 BBa_S03516 . stem_loop 96 115 . + 0 ID=annotation1686;Name=T7 TE;Parent=BBa_B0012 BBa_S03516 . polyA_site 116 129 . + 0 ID=annotation1690;Name=polya;Parent=BBa_B0012 BBa_S03568 . terminator 89 129 . + 0 ID=BBa_B0012;Name=BBa_B0012 BBa_S03568 . stop_codon 122 122 . + 0 ID=annotation1687;Name=stop;Parent=BBa_B0012 BBa_S03568 . engineered_region 89 129 . + 0 ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012 BBa_S03568 . stem_loop 96 115 . + 0 ID=annotation1686;Name=T7 TE;Parent=BBa_B0012 BBa_S03568 . polyA_site 116 129 . + 0 ID=annotation1690;Name=polya;Parent=BBa_B0012 BBa_S03568 . sequence_feature 138 214 . + 0 ID=BBa_J3101;Name=BBa_J3101 BBa_S03568 . non_covalent_binding_site 192 206 . + 0 ID=annotation1884992;Name=Distal Fis Binding Site;Parent=BBa_J3101 BBa_S03568 . sequence_feature 138 214 . + 0 ID=annotation1884988;Name=RE Sequence;Parent=BBa_J3101 BBa_S03568 . sequence_feature 188 193 . + 0 ID=annotation1880471;Name=Former SpeI site;Parent=BBa_J3101 BBa_S03568 . sequence_feature 214 214 . + 0 ID=annotation1884990;Name=Insertion right before biobrick ends;Parent=BBa_J3101 BBa_S03568 . sequence_feature 166 166 . + 0 ID=annotation1884989;Name=Originally a C;Parent=BBa_J3101 BBa_S03568 . non_covalent_binding_site 143 158 . + 0 ID=annotation1884991;Name=Proximal Fis Binding Site;Parent=BBa_J3101 BBa_S03568 . sequence_feature 188 188 . + 0 ID=annotation1880472;Name=Mutation of SpeI site;Parent=BBa_J3101 BBa_S03568 . terminator 1 80 . + 0 ID=BBa_B0010;Name=BBa_B0010 BBa_S03568 . stem_loop 12 55 . + 0 ID=annotation4184;Name=stem_loop;Parent=BBa_B0010 BBa_S03568 . engineered_region 1 80 . + 0 ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010 >BBa_S03516 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctct ctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttcgggtgtcaacaattgacc aaaatattgatttacagcgtaatgcgctttctagtgcaaattgtgaccgcattttg >BBa_S03568 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctct ctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttcgggtgtcaacaattgacc aaaatattgatttacagcgtaatgcgctttctagtgcaaattgtgaccgcattttg