BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_S03568 1 BBa_S03568 B0015:J3101 2006-08-15T11:00:00Z 2015-05-08T01:14:25Z true false _61_ 0 606 61 Discontinued false false Todd Eckdahl component1896997 1 BBa_B0010 component1897009 1 BBa_J3101 component1896999 1 BBa_B0012 annotation1896997 1 BBa_B0010 range1896997 1 1 80 annotation1897009 1 BBa_J3101 range1897009 1 138 214 annotation1896999 1 BBa_B0012 range1896999 1 89 129 BBa_J3101 1 RE Recombinational Enhancer (RE) for Hin/Hix inverting 2006-06-01T11:00:00Z 2015-08-31T04:08:45Z false false _61_ 0 918 61 In stock true true Erin Zwack, Sabriya Rosemond annotation1884988 1 RE Sequence range1884988 1 1 77 annotation1880472 1 Mutation of SpeI site range1880472 1 51 51 annotation1884989 1 Originally a C range1884989 1 29 29 annotation1884992 1 Distal Fis Binding Site range1884992 1 55 69 annotation1884991 1 Proximal Fis Binding Site range1884991 1 6 21 annotation1880471 1 Former SpeI site range1880471 1 51 56 annotation1884990 1 Insertion right before biobrick ends range1884990 1 77 77 BBa_S03516 1 BBa_S03516 TT : RE 2006-07-20T11:00:00Z 2015-05-08T01:14:24Z false true _61_ 0 919 61 It's complicated false false Sabriya Rosemond component1886326 1 BBa_B0012 component1886336 1 BBa_J3101 component1886324 1 BBa_B0010 annotation1886324 1 BBa_B0010 range1886324 1 1 80 annotation1886326 1 BBa_B0012 range1886326 1 89 129 annotation1886336 1 BBa_J3101 range1886336 1 138 214 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J3101_sequence 1 ttcgggtgtcaacaattgaccaaaatattgatttacagcgtaatgcgctttctagtgcaaattgtgaccgcattttg BBa_S03516_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttcgggtgtcaacaattgaccaaaatattgatttacagcgtaatgcgctttctagtgcaaattgtgaccgcattttg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S03568_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttcgggtgtcaacaattgaccaaaatattgatttacagcgtaatgcgctttctagtgcaaattgtgaccgcattttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z