BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961227 1 start range1961227 1 173 173 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961224 1 -35 range1961224 1 137 142 BBa_S03645 1 BBa_S03645 pLac : HixC 2007-02-21T12:00:00Z 2015-05-08T01:14:26Z false false _61_ 0 1144 61 Not in stock false false Karmella Haynes component1911868 1 BBa_R0010 component1911875 1 BBa_J44000 annotation1911875 1 BBa_J44000 range1911875 1 209 234 annotation1911868 1 BBa_R0010 range1911868 1 1 200 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_S03645_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagttatcaaaaaccatggtttttgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z