BBa_B0101 1 HP3 3 HP3 3 2007-02-28T12:00:00Z 2015-08-31T04:07:21Z The part was made by primer annealing. 3' stabilizing mRNA designed by Christina Smolke and Jay Keasling for stabilizing gfp. false false _11_ 0 571 10 Not in stock false A single base pair change (A to T at position 25) from the original design was made in order to remove a PstI site occurring in the loop of the hairpin. This should have no effect on the secondary structure. false Heather Keller annotation1919685 1 stem_loop range1919685 1 6 58 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_S03650 1 BBa_S03650 B0100:B0015 2007-03-05T12:00:00Z 2015-05-08T01:14:26Z Released HQ 2013 false false _10_ 0 571 10 In stock false false Heather Keller component1920491 1 BBa_B0012 component1920489 1 BBa_B0010 component1920488 1 BBa_B0101 annotation1920489 1 BBa_B0010 range1920489 1 67 146 annotation1920491 1 BBa_B0012 range1920491 1 155 195 annotation1920488 1 BBa_B0101 range1920488 1 1 58 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0101_sequence 1 gatcgcctgatcccggtgcacccgggcagctgcatagtctgggtgcaccgggatcagg BBa_S03650_sequence 1 gatcgcctgatcccggtgcacccgggcagctgcatagtctgggtgcaccgggatcaggtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z