BBa_P1010 1 ccdB ccdB cell death gene 2004-07-27T11:00:00Z 2015-05-08T01:14:11Z Deleted The ccd operon having a constitutive promoter and the ccdB coding region. ccdB protein is lethal in normal cloning strains. This part is used to aid the process of moving a BioBrick part to a new plasmid. A target plasmid carrying P1010 is cut and mixed with the cut insert. Plasmids that recombine are selected against because they kill the cell that picks them up. P1010 is only provided as plasmid or in DB3.1 which is ccdB resistant. true true _11_1_ 0 60 7 Discontinued false false Leon Chan annotation1747336 1 -35 (rev) range1747336 1 618 623 annotation1747334 1 T to C mutation range1747334 1 467 467 annotation1747332 1 ccdB (rev) range1747332 1 29 334 annotation1747335 1 -10 (rev) range1747335 1 595 600 annotation1747333 1 ccdA- (rev) range1747333 1 336 556 BBa_S00159 1 BBa_S00159 R0011+B0100+B0048 2007-03-05T12:00:00Z 2015-05-08T01:14:16Z This part was generated by PCR amplification. The upstream biobricks cut sites (EcoRI and XbaI) as well as the R0011 promoter were incorporated into the forward promoter recognizing the ompA region in the MG1655 genome. The AvrII cut site, as well as the downstream biobricks cut sites (SpeI and PstI) were incorporated into the reverse promoter. This part is an intermediate assembly product that contains the R0011 promoter (lambda cI promoter with lacI binding sites), the OmpaA 5' UTR containing a double hairpin for transcript stability, and an AvrII restriction site to facilitate later downstream cloning of an RBS via Heather Keller's RBS characterization scheme. These parts are cloned bluntly, without generating biobricks mixed sites in between. false true _11_ 0 571 10 Not in stock false This part was generated by PCR assembly in order to minimize the number of digestions and ligations necessary to generate a larger construct. Especially given the short sequence of the three individual parts (and the difficulting in purifying small parts) it was much simpler to amplify the product in this way rather than generate the 3 parts individually and clone them together. false Heather Keller annotation1920201 1 ss1 range1920201 1 119 129 annotation1920199 1 -10 range1920199 1 43 48 annotation1920206 1 BBa_B0048 range1920206 1 171 176 annotation1920196 1 lac O1 range1920196 1 3 19 annotation1920205 1 AvrII site range1920205 1 171 176 annotation1920200 1 hp1 range1920200 1 56 118 annotation1920197 1 -35 range1920197 1 20 25 annotation1920203 1 ss2 range1920203 1 159 170 annotation1920195 1 BBa_R0011 range1920195 1 1 54 annotation1920202 1 hp2 range1920202 1 130 158 annotation1920204 1 BBa_B0100 range1920204 1 56 170 annotation1920198 1 lac O1 range1920198 1 26 42 BBa_S03651 1 BBa_S03651 S00159:P1010 2007-03-05T12:00:00Z 2015-06-15T12:38:52Z true false _10_ 4206 571 10 It's complicated false false Heather Keller component1920355 1 BBa_S00159 component1920361 1 BBa_P1010 annotation1920361 1 BBa_P1010 range1920361 1 185 859 annotation1920355 1 BBa_S00159 range1920355 1 1 176 BBa_P1010_sequence 1 actggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgt BBa_S03651_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacagccaggggtgctcggcataagccgaagatatcggtagagttaatattgagcagatcccccggtgaaggatttaaccgtgttatctcgttggagatattcatggcgtattttggatcctaggtactagagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgt BBa_S00159_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacagccaggggtgctcggcataagccgaagatatcggtagagttaatattgagcagatcccccggtgaaggatttaaccgtgttatctcgttggagatattcatggcgtattttggatcctagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z