BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_S03652 1 BBa_S03652 E0041:S03650 2007-03-05T12:00:00Z 2015-05-08T01:14:26Z false false _10_ 0 571 10 In stock false false Heather Keller component1920515 1 BBa_B0010 component1920512 1 BBa_E0041 component1920517 1 BBa_B0012 component1920514 1 BBa_B0101 annotation1920512 1 BBa_E0041 range1920512 1 1 728 annotation1920514 1 BBa_B0101 range1920514 1 737 794 annotation1920517 1 BBa_B0012 range1920517 1 891 931 annotation1920515 1 BBa_B0010 range1920515 1 803 882 BBa_E0041 1 BBa_E0041 SapI + GFP 2007-03-05T12:00:00Z 2015-08-31T04:07:25Z The part was generated by PCR amplification of part E0040 with the SapI site incorported into the forward promoter. GFP (mut3) part number E0040 with a unpstream SapI site. Cleave with SapI results in an overhang of 3'-TAC - 5' from the left end of the GFP coding region, making the coding sequence compatible with Heather Keller's alternative assembly method for blunt cloning of RBS sequences upstream of a coding sequence. false false _11_ 0 571 10 Not in stock false n/a false Heather Keller annotation1920211 1 BBa_B0102 range1920211 1 1 8 annotation1920210 1 SapI recognition range1920210 1 1 7 annotation1920212 1 BBa_E0040 range1920212 1 9 728 BBa_B0101 1 HP3 3 HP3 3 2007-02-28T12:00:00Z 2015-08-31T04:07:21Z The part was made by primer annealing. 3' stabilizing mRNA designed by Christina Smolke and Jay Keasling for stabilizing gfp. false false _11_ 0 571 10 Not in stock false A single base pair change (A to T at position 25) from the original design was made in order to remove a PstI site occurring in the loop of the hairpin. This should have no effect on the secondary structure. false Heather Keller annotation1919685 1 stem_loop range1919685 1 6 58 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S03652_sequence 1 gctcttctatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagaggatcgcctgatcccggtgcacccgggcagctgcatagtctgggtgcaccgggatcaggtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0041_sequence 1 gctcttctatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0101_sequence 1 gatcgcctgatcccggtgcacccgggcagctgcatagtctgggtgcaccgggatcagg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z