BBa_I13025 1 BBa_I13025 mnt QPI Intermediate 2004-07-14T11:00:00Z 2015-08-31T04:07:32Z Released HQ 2013 -- No description -- false false _6_ 0 159 7 In stock false false jenmitch component939411 1 BBa_B0034 component939424 1 BBa_C0072 annotation939411 1 BBa_B0034 range939411 1 1 12 annotation939424 1 BBa_C0072 range939424 1 19 306 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S03657 1 BBa_S03657 I13025:B0014 2007-03-28T11:00:00Z 2015-05-08T01:14:26Z false false _84_ 0 2 84 It's complicated false false Jason Kelly component2248568 1 BBa_B0014 component2248561 1 BBa_I13025 annotation2248568 1 BBa_B0014 range2248568 1 340 434 annotation2248561 1 BBa_I13025 range2248561 1 1 331 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_C0072 1 mnt (s) mnt repressor (strong) from Salmonella phage P22 (+LVA) 2004-01-28T12:00:00Z 2015-08-31T04:07:23Z enterobacteriophage p22 Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false wild type dimeric repressor from enterobacteriophage p22 with dissociation constant of 2.5*10^-12.<br/><br/> sequence was translated with the E.Coli K12 codon usage table, and nucleotides 95-97 was changed from AAT to AAC to avoid the cut site GAATTC (94-99).<br/><br/> Identification of Functionally Important Residues in the DNA Binding Region of the MNT Repressor <br/> Kendall, KL; Sauer, RT <br/> The Journal of Biological Chemistry, 264(23):13706-13710, 1989 true crackdots annotation308502 1 T range308502 1 95 97 annotation308499 1 mnt range308499 1 1 249 annotation2214010 1 Help:Barcodes range2214010 1 289 313 annotation308503 1 LVA range308503 1 250 282 BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0034_sequence 1 aaagaggagaaa BBa_C0072_sequence 1 atggcccgggatgatcctcacttcaattttcgtatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc BBa_S03657_sequence 1 aaagaggagaaatactagatggcccgggatgatcctcacttcaattttcgtatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_I13025_sequence 1 aaagaggagaaatactagatggcccgggatgatcctcacttcaattttcgtatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z