BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2024 1 OR1 range2024 1 25 41 annotation2022 1 -10 range2022 1 38 43 annotation2023 1 -35 range2023 1 15 20 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2025 1 OR2 range2025 1 1 17 BBa_S03668 1 BBa_S03668 B0014:R0051 2007-03-28T11:00:00Z 2015-05-08T01:14:28Z false true _84_ 0 2 84 It's complicated false false Jason Kelly component1923514 1 BBa_R0051 component1923507 1 BBa_B0012 component1923511 1 BBa_B0011 annotation1923507 1 BBa_B0012 range1923507 1 1 41 annotation1923511 1 BBa_B0011 range1923511 1 50 95 annotation1923514 1 BBa_R0051 range1923514 1 104 152 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S03668_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z