BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_S03678 1 BBa_S03678 pLac_rev : HixC 2007-05-07T11:00:00Z 2015-05-08T01:14:28Z false false _61_ 0 1144 61 Not in stock false false Karmella Haynes component1932416 1 BBa_J31013 component1932417 1 BBa_J44000 annotation1932416 1 BBa_J31013 range1932416 1 1 200 annotation1932417 1 BBa_J44000 range1932417 1 209 234 BBa_J31013 1 BBa_J31013 pLac Backwards [cf. BBa_R0010] 2007-04-11T11:00:00Z 2015-08-31T04:08:45Z BBa_R0010 Promoter from the lack operon cloned in the reverse orientation. false false _61_ 0 1144 61 Not in stock false Promoter from the lack operon cloned in the reverse orientation. false Karmella Haynes annotation1928670 1 CAP binding site range1928670 1 74 112 annotation1928672 1 -10 range1928672 1 35 40 annotation1928669 1 end of LacI coding region (inactive) range1928669 1 113 200 annotation1928673 1 LacI binding site range1928673 1 1 34 annotation1928671 1 -35 range1928671 1 58 64 annotation1928668 1 R0010 reverse range1928668 1 1 200 BBa_S03678_sequence 1 tgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgtactagagttatcaaaaaccatggtttttgataa BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_J31013_sequence 1 tgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z