BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_S03712 1 BBa_S03712 pLacB-RBS.1 2007-06-18T11:00:00Z 2015-05-08T01:14:29Z false false _120_ 0 1491 9 It's complicated false false Will DeLoache component1934954 1 BBa_B0030 component1934952 1 BBa_J31013 annotation1934952 1 BBa_J31013 range1934952 1 1 200 annotation1934954 1 BBa_B0030 range1934954 1 209 223 BBa_J31013 1 BBa_J31013 pLac Backwards [cf. BBa_R0010] 2007-04-11T11:00:00Z 2015-08-31T04:08:45Z BBa_R0010 Promoter from the lack operon cloned in the reverse orientation. false false _61_ 0 1144 61 Not in stock false Promoter from the lack operon cloned in the reverse orientation. false Karmella Haynes annotation1928672 1 -10 range1928672 1 35 40 annotation1928669 1 end of LacI coding region (inactive) range1928669 1 113 200 annotation1928668 1 R0010 reverse range1928668 1 1 200 annotation1928671 1 -35 range1928671 1 58 64 annotation1928673 1 LacI binding site range1928673 1 1 34 annotation1928670 1 CAP binding site range1928670 1 74 112 BBa_B0030_sequence 1 attaaagaggagaaa BBa_S03712_sequence 1 tgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgtactagagattaaagaggagaaa BBa_J31013_sequence 1 tgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z