BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I715000 1 CreA Amino Half of Cre Recombinase (aka CreA) 2007-06-26T11:00:00Z 2015-08-31T04:07:49Z BBa_J61047 The amino half of the Cre recombinase gene (BBa_J61047) was cloned into plasmid pSB1A2. This half contains the first 570 base pairs in the gene. The carboxyl half (BBa_I7165) of the Cre recombinase gene was also cloned into plasmid pSB1A2 and contains the remaining 462 base pairs of the gene. Our eventual goal was to insert a hixC site in the middle of the gene while maintaining Cre recombinase's functionality. The location of our split site was chosen based off of outside literature in which Cre Recombinase had been successfully split as well as the protein structure of Cre recombinase. false false _120_ 0 1491 9 Not in stock false None false Will DeLoache annotation1935691 1 CreA range1935691 1 1 570 annotation1935690 1 start range1935690 1 1 3 BBa_S03727 1 BBa_S03727 RBS-CreA 2007-07-01T11:00:00Z 2015-05-08T01:14:29Z false false _120_ 0 1491 9 Not in stock false false Will DeLoache component1936122 1 BBa_B0034 component1936125 1 BBa_I715000 annotation1936125 1 BBa_I715000 range1936125 1 19 588 annotation1936122 1 BBa_B0034 range1936122 1 1 12 BBa_I715000_sequence 1 atgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggt BBa_S03727_sequence 1 aaagaggagaaatactagatgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggt BBa_B0034_sequence 1 aaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z