BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_S03728 1 BBa_S03728 hixC-CreB 2007-07-01T11:00:00Z 2015-05-08T01:14:29Z false false _120_ 0 1491 9 Not in stock false false Will DeLoache component1936127 1 BBa_J44000 component1936130 1 BBa_I715001 annotation1936130 1 BBa_I715001 range1936130 1 35 497 annotation1936127 1 BBa_J44000 range1936127 1 1 26 BBa_I715001 1 CreB Carboxl Half of Cre Recombinase (aka CreB) 2007-06-26T11:00:00Z 2015-08-31T04:07:49Z BBa_J61047 The carboxyl half of the Cre recombinase gene (BBa_J61047) was cloned into plasmid pSB1A2. This half contains the last 462 base pairs in the gene. The amino half (BBa_I716500) of the Cre recombinase gene was also cloned into plasmid pSB1A2 and contains the first 570 base pairs of the gene. Our eventual goal is to insert a hixC site in the middle of the gene while maintaining Cre recombinase's functionality. The location of our split site was chosen based off of outside literature that demonstrated the successful splitting of Cre Recombinase, as well as the protein structure of Cre recombinase. false false _120_ 0 1491 9 Not in stock false None false Will DeLoache annotation1935692 1 Inserted Base range1935692 1 1 1 annotation1935689 1 stop range1935689 1 461 463 annotation1935688 1 CreB range1935688 1 2 460 BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_I715001_sequence 1 tgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattag BBa_S03728_sequence 1 ttatcaaaaaccatggtttttgataatactagagtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z