BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J31001 1 Hin LVA DNA invertase Hin tagged with LVA 2006-07-11T11:00:00Z 2015-08-31T04:08:45Z Salmonella typhimurium and the the Hin part without LVA. This part produces the Hin protein with an LVA degredation tag. We are currently looking into this as a way to ensure no Hin is floating around once we turn off the Hin promoter. false false _61_ 0 918 61 In stock true None really false Erin Zwack, Sabriya Rosemond annotation1910567 1 Stop codon range1910567 1 610 612 annotation1910566 1 LVA range1910566 1 571 609 annotation1910570 1 Rev primer J31001 range1910570 1 551 612 annotation1910565 1 Fwd primer J31001 range1910565 1 1 3 annotation1910564 1 Hin range1910564 1 1 570 BBa_J44001 1 BBa_J44001 Reverse RBS (RBS<sub>rev</sub>) -- corresponds to BBa_B0030 2006-08-01T11:00:00Z 2015-08-31T04:08:48Z Cloned from synthetic oligos Released HQ 2013 Reverse version of RBS BBa_B0030 false false _61_71_ 0 606 61 In stock true Repeats in oligos caused unusual products during cloning true Todd Eckdahl annotation1893199 1 Reverse RBS range1893199 1 1 15 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961224 1 -35 range1961224 1 137 142 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961227 1 start range1961227 1 173 173 BBa_S03730 1 BBa_S03730 Hin-LVA with inducible promoter 2007-07-02T11:00:00Z 2015-05-08T01:14:29Z false false _120_ 0 1518 9 It's complicated false false Jordan Baumgardner component1936224 1 BBa_B0012 component1936214 1 BBa_B0030 component1936222 1 BBa_B0010 component1936221 1 BBa_J31001 component1936205 1 BBa_J44001 component1936206 1 BBa_R0010 annotation1936221 1 BBa_J31001 range1936221 1 253 864 annotation1936222 1 BBa_B0010 range1936222 1 873 952 annotation1936214 1 BBa_B0030 range1936214 1 232 246 annotation1936206 1 BBa_R0010 range1936206 1 24 223 annotation1936224 1 BBa_B0012 range1936224 1 961 1001 annotation1936205 1 BBa_J44001 range1936205 1 1 15 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_J44001_sequence 1 tttctcctctttaat BBa_B0030_sequence 1 attaaagaggagaaa BBa_S03730_sequence 1 tttctcctctttaattactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagattaaagaggagaaatactagatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaggaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgagcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgcagcgtgaaaaacctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaattgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacagacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaactagctattatttttggtattggcgtatctaccttatacagatattttccggcaagccgtataaaaaaacgaatgaataggcctgctgcaaacgacgaaaactacgctttagtagcttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J31001_sequence 1 atggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaggaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgagcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgcagcgtgaaaaacctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaattgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacagacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaactagctattatttttggtattggcgtatctaccttatacagatattttccggcaagccgtataaaaaaacgaatgaataggcctgctgcaaacgacgaaaactacgctttagtagcttaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z