BBa_I715004 1 BBa_I715004 Amino Half of of Kanamycin (Kan1) 2007-07-02T11:00:00Z 2015-08-31T04:07:49Z E.Coli Genome First half of Kanamycin split at 125 AA or the 375 bp. false false _120_ 0 1761 9 Not in stock false None false Michael Waters annotation1936233 1 Kan1 range1936233 1 1 375 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S03733 1 BBa_S03733 RBS 2.:Amino Half of Kan 2007-07-02T11:00:00Z 2015-05-08T01:14:29Z false false _120_ 0 1761 9 Not in stock false false Michael Waters component1936244 1 BBa_B0034 component1936246 1 BBa_I715004 annotation1936244 1 BBa_B0034 range1936244 1 1 12 annotation1936246 1 BBa_I715004 range1936246 1 19 393 BBa_S03733_sequence 1 aaagaggagaaatactagatgagccatattcaacgggaaacgtcttgctccaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccgggaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggca BBa_B0034_sequence 1 aaagaggagaaa BBa_I715004_sequence 1 atgagccatattcaacgggaaacgtcttgctccaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccgggaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z