BBa_I715000 1 CreA Amino Half of Cre Recombinase (aka CreA) 2007-06-26T11:00:00Z 2015-08-31T04:07:49Z BBa_J61047 The amino half of the Cre recombinase gene (BBa_J61047) was cloned into plasmid pSB1A2. This half contains the first 570 base pairs in the gene. The carboxyl half (BBa_I7165) of the Cre recombinase gene was also cloned into plasmid pSB1A2 and contains the remaining 462 base pairs of the gene. Our eventual goal was to insert a hixC site in the middle of the gene while maintaining Cre recombinase's functionality. The location of our split site was chosen based off of outside literature in which Cre Recombinase had been successfully split as well as the protein structure of Cre recombinase. false false _120_ 0 1491 9 Not in stock false None false Will DeLoache annotation1935691 1 CreA range1935691 1 1 570 annotation1935690 1 start range1935690 1 1 3 BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_S03735 1 BBa_S03735 RBS-CreA-hixC-CreB 2007-07-02T11:00:00Z 2015-05-08T01:14:29Z false false _120_ 0 1491 9 Not in stock false false Will DeLoache component1936376 1 BBa_I715000 component1936380 1 BBa_I715001 component1936377 1 BBa_J44000 component1936373 1 BBa_B0034 annotation1936376 1 BBa_I715000 range1936376 1 19 588 annotation1936377 1 BBa_J44000 range1936377 1 597 622 annotation1936380 1 BBa_I715001 range1936380 1 631 1093 annotation1936373 1 BBa_B0034 range1936373 1 1 12 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I715001 1 CreB Carboxl Half of Cre Recombinase (aka CreB) 2007-06-26T11:00:00Z 2015-08-31T04:07:49Z BBa_J61047 The carboxyl half of the Cre recombinase gene (BBa_J61047) was cloned into plasmid pSB1A2. This half contains the last 462 base pairs in the gene. The amino half (BBa_I716500) of the Cre recombinase gene was also cloned into plasmid pSB1A2 and contains the first 570 base pairs of the gene. Our eventual goal is to insert a hixC site in the middle of the gene while maintaining Cre recombinase's functionality. The location of our split site was chosen based off of outside literature that demonstrated the successful splitting of Cre Recombinase, as well as the protein structure of Cre recombinase. false false _120_ 0 1491 9 Not in stock false None false Will DeLoache annotation1935692 1 Inserted Base range1935692 1 1 1 annotation1935689 1 stop range1935689 1 461 463 annotation1935688 1 CreB range1935688 1 2 460 BBa_I715000_sequence 1 atgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggt BBa_B0034_sequence 1 aaagaggagaaa BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_I715001_sequence 1 tgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattag BBa_S03735_sequence 1 aaagaggagaaatactagatgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggttactagagttatcaaaaaccatggtttttgataatactagagtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z