##gff-version 3
##sequence-region BBa_S03739 1 220
##sequence-region BBa_J04500 1 220
BBa_S03739	.	ribosome_entry_site	209	220	.	+	0	ID=BBa_B0034;Name=BBa_B0034
BBa_S03739	.	conserved_region	213	216	.	+	0	ID=annotation23325;Name=conserved;Parent=BBa_B0034
BBa_S03739	.	promoter	1	200	.	+	0	ID=BBa_R0010;Name=BBa_R0010
BBa_S03739	.	CDS	1	88	.	+	0	ID=annotation1961221;Name=end of LacI coding region (inactive);Parent=BBa_R0010
BBa_S03739	.	non_covalent_binding_site	166	200	.	+	0	ID=annotation1961226;Name=LacI binding site;Parent=BBa_R0010
BBa_S03739	.	promoter	161	166	.	+	0	ID=annotation1961225;Name=-10;Parent=BBa_R0010
BBa_S03739	.	promoter	137	142	.	+	0	ID=annotation1961224;Name=-35;Parent=BBa_R0010
BBa_S03739	.	non_covalent_binding_site	89	126	.	+	0	ID=annotation1961223;Name=CAP binding site;Parent=BBa_R0010
BBa_S03739	.	start_codon	173	173	.	+	0	ID=annotation1961227;Name=start;Parent=BBa_R0010
BBa_S03739	.	engineered_region	1	200	.	+	0	ID=annotation1961222;Name=BBa_R0010;Parent=BBa_R0010
BBa_J04500	.	promoter	1	200	.	+	0	ID=BBa_R0010;Name=BBa_R0010
BBa_J04500	.	CDS	1	88	.	+	0	ID=annotation1961221;Name=end of LacI coding region (inactive);Parent=BBa_R0010
BBa_J04500	.	non_covalent_binding_site	166	200	.	+	0	ID=annotation1961226;Name=LacI binding site;Parent=BBa_R0010
BBa_J04500	.	promoter	161	166	.	+	0	ID=annotation1961225;Name=-10;Parent=BBa_R0010
BBa_J04500	.	promoter	137	142	.	+	0	ID=annotation1961224;Name=-35;Parent=BBa_R0010
BBa_J04500	.	non_covalent_binding_site	89	126	.	+	0	ID=annotation1961223;Name=CAP binding site;Parent=BBa_R0010
BBa_J04500	.	start_codon	173	173	.	+	0	ID=annotation1961227;Name=start;Parent=BBa_R0010
BBa_J04500	.	engineered_region	1	200	.	+	0	ID=annotation1961222;Name=BBa_R0010;Parent=BBa_R0010
BBa_J04500	.	ribosome_entry_site	209	220	.	+	0	ID=BBa_B0034;Name=BBa_B0034
BBa_J04500	.	conserved_region	213	216	.	+	0	ID=annotation23325;Name=conserved;Parent=BBa_B0034
>BBa_S03739
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc
gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggct
cgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa
>BBa_J04500
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc
gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggct
cgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa