BBa_I715022 1 RFP1 Amino Portion of RFP 2007-06-24T11:00:00Z 2016-01-25T04:43:58Z adf Released HQ 2013 af false false _120_ 4206 201 61 In stock false afd true Andrew Martens annotation1935380 1 start range1935380 1 1 3 annotation1935381 1 Coding sequence range1935381 1 1 462 BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I715020 1 GFP2 Carboxyl Half of GFP (aka GFP2) 2007-06-21T11:00:00Z 2015-08-31T04:07:49Z A Released HQ 2013 A false false _120_ 0 1491 9 In stock false A true Will DeLoache annotation1935360 1 extra base to maintain reading frame range1935360 1 1 1 annotation1935362 1 Stop Codons (two in tandem) range1935362 1 245 250 annotation1935361 1 Coding Carboxyl half of GFP (aka GFP2) range1935361 1 1 244 BBa_S03760 1 BBa_S03760 RBS-RFP1-HixC-GFP2 2007-07-27T11:00:00Z 2015-05-08T01:14:30Z false false _120_ 0 1620 9 It's complicated false false Andrew Martens component1939993 1 BBa_I715022 component1939997 1 BBa_I715020 component1939994 1 BBa_J44000 component1939990 1 BBa_B0034 annotation1939994 1 BBa_J44000 range1939994 1 489 514 annotation1939990 1 BBa_B0034 range1939990 1 1 12 annotation1939993 1 BBa_I715022 range1939993 1 19 480 annotation1939997 1 BBa_I715020 range1939997 1 523 772 BBa_B0034_sequence 1 aaagaggagaaa BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_I715020_sequence 1 taagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_S03760_sequence 1 aaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagactactagagttatcaaaaaccatggtttttgataatactagagtaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_I715022_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z