BBa_S03768 1 BBa_S03768 RBS-Chlora1 2007-07-31T11:00:00Z 2015-05-08T01:14:30Z false false _120_ 0 1491 9 Not in stock false false Oyinade Adefuye component1940538 1 BBa_B0034 component1940541 1 BBa_I715024 annotation1940541 1 BBa_I715024 range1940541 1 19 174 annotation1940538 1 BBa_B0034 range1940538 1 1 12 BBa_I715024 1 BBa_I715024 Amino Half of CAT (aka 1Chlora) 2007-06-25T11:00:00Z 2015-08-31T04:07:49Z asfa gsg false false _120_ 0 201 61 Not in stock false afad false Malcolm Campbell annotation1936094 1 Coding region of CAT range1936094 1 1 156 annotation1936093 1 Start Codon range1936093 1 1 3 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I715024_sequence 1 atggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataag BBa_S03768_sequence 1 aaagaggagaaatactagatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataag BBa_B0034_sequence 1 aaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z