BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23008 1 BBa_J23008 [key3c] riboregulator for lock3 variants 2006-07-09T11:00:00Z 2015-08-31T04:08:38Z J23007 This part has the same homology region to J01122 as J23007 except that unlike J23007, J23008 does not contain the hairpin that was derived from J01129. J23008 anneals linearly to the stem of the hairpin in J01122 with perfect base pairing and destroys the hairpin in the process and reveals the RBS on J01122. When J01122 is transcribed the RNA secondary structure is such that the RBS hairpins with sequence upstream preventing the ribosome from binding and translation from occuring thereby locking up RFP further down stream. When J23008 is introduced into the cell in trans, we suspect that it will unlock the RBS for RFP as described above allowing translation to occur. false false _52_ 0 931 52 In stock false No design considerations true Kaitlin Davis BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_S03774 1 BBa_S03774 J23008:B0015 2007-08-07T11:00:00Z 2015-05-08T01:14:30Z false false _9_ 0 1800 9 Not in stock false false Patrick King component1940995 1 BBa_B0010 component1940997 1 BBa_B0012 component1940994 1 BBa_J23008 annotation1940995 1 BBa_B0010 range1940995 1 103 182 annotation1940994 1 BBa_J23008 range1940994 1 1 94 annotation1940997 1 BBa_B0012 range1940997 1 191 231 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S03774_sequence 1 acccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23008_sequence 1 acccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z