BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_I715020 1 GFP2 Carboxyl Half of GFP (aka GFP2) 2007-06-21T11:00:00Z 2015-08-31T04:07:49Z A Released HQ 2013 A false false _120_ 0 1491 9 In stock false A true Will DeLoache annotation1935361 1 Coding Carboxyl half of GFP (aka GFP2) range1935361 1 1 244 annotation1935360 1 extra base to maintain reading frame range1935360 1 1 1 annotation1935362 1 Stop Codons (two in tandem) range1935362 1 245 250 BBa_S03777 1 BBa_S03777 hixC-GFP2-TT 2007-08-14T11:00:00Z 2015-05-08T01:14:30Z false false _120_ 0 1803 9 It's complicated false false Tom Crowley component1941323 1 BBa_I715020 component1941320 1 BBa_J44000 component1941326 1 BBa_B0012 component1941324 1 BBa_B0010 annotation1941320 1 BBa_J44000 range1941320 1 1 26 annotation1941323 1 BBa_I715020 range1941323 1 35 284 annotation1941326 1 BBa_B0012 range1941326 1 381 421 annotation1941324 1 BBa_B0010 range1941324 1 293 372 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S03777_sequence 1 ttatcaaaaaccatggtttttgataatactagagtaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_I715020_sequence 1 taagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z