BBa_S03849 1 BBa_S03849 J37028:B0015 2007-10-25T11:00:00Z 2015-05-08T01:14:31Z Released HQ 2013 false true _9_ 0 1481 9 In stock false false David Bikard component1956096 1 BBa_J37028 component1956099 1 BBa_B0012 component1956097 1 BBa_B0010 annotation1956097 1 BBa_B0010 range1956097 1 43 122 annotation1956099 1 BBa_B0012 range1956099 1 131 171 annotation1956096 1 BBa_J37028 range1956096 1 1 34 BBa_J37028 1 BBa_J37028 Lox71 2006-07-31T11:00:00Z 2015-08-31T04:08:48Z Zuwen Zhang and Beat Lutz (2002) Cre Recombinase-mediated inversion using lox66 and lox71: method to introduce conditional point mutations into the CREB-binding protein NUCLEAIC ACIDS RESEARCH Released HQ 2013 This is a mutated sequence taken from (Zhang and Lutz 2002) It is a Lox site which can be bound by The enzyme Cre Recombinase false true _66_ 0 1068 66 In stock false NA false John Chattaway BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J37028_sequence 1 taccgttcgtatacgatacattatacgaagttat BBa_S03849_sequence 1 taccgttcgtatacgatacattatacgaagttattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z