BBa_S03894 1 BBa_S03894 B0034:I761002 2007-10-25T11:00:00Z 2015-05-08T01:14:32Z false false _140_ 0 2032 9 Not in stock false false 2007 NYMU_Taiwan iGEM Team component1957816 1 BBa_B0034 component1957819 1 BBa_I761002 annotation1957816 1 BBa_B0034 range1957816 1 1 12 annotation1957819 1 BBa_I761002 range1957819 1 19 169 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I761002 1 BBa_I761002 TAT signal+INS_A 2007-10-18T11:00:00Z 2015-08-31T04:08:08Z NCBI accession number: BC005255 K12 E. coli genomic DNA Twin arginin signal peptide is an efficient protein export signal sequence of E. coli. The purpose of this construct is to allow E. coli export insulin automatically, obviate the need to extract insulin by biochemical method. false false _140_ 0 2031 9 Not in stock false To combine TAT signal and INS_A, we used two separate PCR reaction to amplify each DNA fragment. We design the reverse primer of TAT signal and the forward primer of INS_A to be complement to each other, so when we mixed the product of each PCR reaction together, than used the forward primer of TAT signal and the reverse primer of INS_A to conduct PCR reaction, we can isolate the combine DNA product of TAT signal and INS_A. (Method devised by Dr. Chang) false 2007 NYMU_Taiwan iGEM Team annotation1949759 1 Human insulin A fragment range1949759 1 89 151 annotation1949758 1 TAT peptide export signal range1949758 1 4 88 BBa_S03894_sequence 1 aaagaggagaaatactagatggacaaattcgacgctaatcgccgcaaattgctggcgcttggtggcgttgcactcggtgccgccatcctgccgacccctgcgtttgcaggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgca BBa_B0034_sequence 1 aaagaggagaaa BBa_I761002_sequence 1 atggacaaattcgacgctaatcgccgcaaattgctggcgcttggtggcgttgcactcggtgccgccatcctgccgacccctgcgtttgcaggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z