BBa_R0184 1 BBa_R0184 T7 promoter (lacI repressible) 2007-04-25T11:00:00Z 2015-05-08T01:14:15Z This sequence is based on the T7lac promoter described by Dubendorff and Studier (JMB 1991, 219, 45-59). The only modification is the mutation at -16. A mutant version of the T7lac promoter designed by Dubendorff and Studier. The promoter is based on the strong ??10 T7 promoter but incorporates an A->C mutation at -16. The LacI operator site is a partially symmetric 25bp sequence. false false _11_ 0 135 84 Not in stock false The -16 mutation was included to weaken the consensus promoter as described by Imburgio and co-workers (see BBa_R0183 for more information) false Bartholomew Canton annotation1932678 1 BBa_R0183 fragment range1932678 1 1 20 annotation1932679 1 lacI binding site range1932679 1 20 44 annotation1932680 1 Center of binding site symmetry range1932680 1 31 31 BBa_B0073 1 BBa_B0073 Specialized RBS 2006-05-01T11:00:00Z 2015-08-31T04:07:21Z -- No description -- false false _11_6_ 0 135 6 Not in stock false false Bartholomew Canton BBa_S03909 1 BBa_S03909 R0184:B0073 2007-11-29T12:00:00Z 2015-05-08T01:14:32Z false false _84_ 0 135 84 Not in stock false false Bartholomew Canton component2218467 1 BBa_B0073 component2218466 1 BBa_R0184 annotation2218466 1 BBa_R0184 range2218466 1 1 44 annotation2218467 1 BBa_B0073 range2218467 1 53 61 BBa_S03909_sequence 1 tcatacgactcactataggggaattgtgagcggataacaattcctactagagtcacaccac BBa_R0184_sequence 1 tcatacgactcactataggggaattgtgagcggataacaattcc BBa_B0073_sequence 1 tcacaccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z