BBa_S03934 1 BBa_S03934 J23150:B0032 2008-03-19T12:00:00Z 2015-05-08T01:14:32Z false false _58_ 0 604 58 Not in stock false false John Cumbers component1961771 1 BBa_J23150 component1961773 1 BBa_B0032 annotation1961773 1 BBa_B0032 range1961773 1 44 56 annotation1961771 1 BBa_J23150 range1961771 1 1 35 BBa_J23150 1 BBa_J23150 1bp mutant from J23107 2008-02-11T12:00:00Z 2015-08-31T04:08:41Z .. Released HQ 2013 . false true _11_ 0 2 84 In stock false . false Jason Kelly BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_J23150_sequence 1 tttacggctagctcagtcctaggtattatgctagc BBa_S03934_sequence 1 tttacggctagctcagtcctaggtattatgctagctactagagtcacacaggaaag BBa_B0032_sequence 1 tcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z