BBa_K137009 1 folB folB (dihydroneopterin aldolase) 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z L.lactis folB is part of the L.lactis folate gene cluster. false false _187_ 0 2987 9 It's complicated false We were unsure of whether or not the L.lactis RBS would work with E. coli and so we are going to try cloning the entire gene cluster with the RBSs as well as cloning out each gene separately and adding E.coli RBSs. false Victoria Hsiao BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S03957 1 folB+b0034 K137009:B0034 2008-07-06T11:00:00Z 2015-05-08T01:14:33Z false false _187_ 0 2987 9 It's complicated false false Victoria Hsiao component1965714 1 BBa_K137009 component1965713 1 BBa_B0034 annotation1965714 1 BBa_K137009 range1965714 1 19 372 annotation1965713 1 BBa_B0034 range1965713 1 1 12 BBa_B0034_sequence 1 aaagaggagaaa BBa_K137009_sequence 1 atgtacaaaataaaacttaataatatgaaatttagagcacatattggtgttctgccagaagaaaaagttctcggacaaaatctcgaaattgatttaatcgtggaaacaaattttgatttttcaggaaaagacgaattagatgaaactttgtcttatgttgatttctatgaggcaacaaaagcagttgtagaatcttcaaaagctgatttaattgaacatgttgcctttgaaattattcaagcagtaaaggctacttcagagcgtatatcaacggttgaagtccatcttagaaaattagccgtaccgattgaaggaatttttgattcagctgaaatcgagatgagagggtaataa BBa_S03957_sequence 1 aaagaggagaaatactagatgtacaaaataaaacttaataatatgaaatttagagcacatattggtgttctgccagaagaaaaagttctcggacaaaatctcgaaattgatttaatcgtggaaacaaattttgatttttcaggaaaagacgaattagatgaaactttgtcttatgttgatttctatgaggcaacaaaagcagttgtagaatcttcaaaagctgatttaattgaacatgttgcctttgaaattattcaagcagtaaaggctacttcagagcgtatatcaacggttgaagtccatcttagaaaattagccgtaccgattgaaggaatttttgattcagctgaaatcgagatgagagggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z