BBa_S04004 1 BBa_S04004 K137010:K137046 2008-07-21T11:00:00Z 2015-05-08T01:14:33Z false true _187_ 0 3112 9 It's complicated false false Allen Lin component1968085 1 BBa_K137010 component1968087 1 BBa_K137046 annotation1968085 1 BBa_K137010 range1968085 1 1 35 annotation1968087 1 BBa_K137046 range1968087 1 44 193 BBa_K137010 1 fimE IRL fimE IRL 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat left recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963844 1 IRL out range1963844 1 19 35 annotation1963843 1 IRL in range1963843 1 1 17 BBa_K137046 1 BBa_K137046 150 bp inverted tetR promoter 2008-07-20T11:00:00Z 2015-05-08T01:10:09Z Primers were synthesized to bind to part Q04400, and then a PCR reaction was run. tetR promoter with noncoding, spacer DNA upstream of it to make the total length 150 bp false false _187_ 0 3112 9 It's complicated false This part is in a series of tetR promoter that have total lengths of 150, 250, 350, 450, 650, and 850 bp. We chose the region upstream of tetR in part Q04400 to be the noncoding DNA segment. This noncoding segment consists of the 3' end of tetR and B0015. None of the parts in this series was long enough to include the start codon of tetR, so a functional tetR protein should not be transcribed. false Allen Lin annotation1968019 1 tetR promoter range1968019 1 1 54 BBa_S03999 1 BBa_S03999 K137010:K137046 2008-07-21T11:00:00Z 2015-05-08T01:14:33Z true false _9_ 0 3112 9 Discontinued false false Allen Lin component1968040 1 BBa_K137010 component1968042 1 BBa_K137046 annotation1968040 1 BBa_K137010 range1968040 1 1 35 annotation1968042 1 BBa_K137046 range1968042 1 44 193 BBa_K137010_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatt BBa_S03999_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatttactagaggtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggc BBa_K137046_sequence 1 gtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggc BBa_S04004_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatttactagaggtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z