BBa_K137010 1 fimE IRL fimE IRL 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat left recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963843 1 IRL in range1963843 1 1 17 annotation1963844 1 IRL out range1963844 1 19 35 BBa_S04006 1 BBa_S04006 K137010:K137048 2008-07-21T11:00:00Z 2015-05-08T01:14:33Z false false _187_ 0 3112 9 It's complicated false false Allen Lin component1968062 1 BBa_K137048 component1968060 1 BBa_K137010 annotation1968062 1 BBa_K137048 range1968062 1 44 393 annotation1968060 1 BBa_K137010 range1968060 1 1 35 BBa_K137048 1 BBa_K137048 350 bp inverted tetR promoter 2008-07-20T11:00:00Z 2015-05-08T01:10:09Z Primers were synthesized to bind to part Q04400, and then a PCR reaction was run. Inverted tetR promoter with noncoding, spacer DNA upstream of it to make the total length 350 bp. false false _187_ 0 3112 9 It's complicated false This part is in a series of inverted tetR promoters that have total lengths of 150, 250, 350, 450, 650, and 850 bp. We chose the region upstream of tetR in part Q04400 to be the noncoding DNA segment. This noncoding segment consists of the 3' end of tetR and B0015. None of the parts in this series was long enough to include the start codon of tetR, so a functional tetR protein should not be transcribed. false Allen Lin annotation1968021 1 tetR promoter range1968021 1 1 54 BBa_K137048_sequence 1 gtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagtgatctacactagcactatcagtgttattaagctactaaagcgtagttttcgtcgtttgcagcggacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtg BBa_K137010_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatt BBa_S04006_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatttactagaggtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagtgatctacactagcactatcagtgttattaagctactaaagcgtagttttcgtcgtttgcagcggacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z