BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K137009 1 folB folB (dihydroneopterin aldolase) 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z L.lactis folB is part of the L.lactis folate gene cluster. false false _187_ 0 2987 9 It's complicated false We were unsure of whether or not the L.lactis RBS would work with E. coli and so we are going to try cloning the entire gene cluster with the RBSs as well as cloning out each gene separately and adding E.coli RBSs. false Victoria Hsiao BBa_S04032 1 folB+b0034 J23100:S03957 2008-07-27T11:00:00Z 2015-05-08T01:14:34Z false false _187_ 0 2987 9 It's complicated false false Victoria Hsiao component1969054 1 BBa_B0034 component1969055 1 BBa_K137009 component1969052 1 BBa_J23100 annotation1969052 1 BBa_J23100 range1969052 1 1 35 annotation1969054 1 BBa_B0034 range1969054 1 44 55 annotation1969055 1 BBa_K137009 range1969055 1 62 415 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K137009_sequence 1 atgtacaaaataaaacttaataatatgaaatttagagcacatattggtgttctgccagaagaaaaagttctcggacaaaatctcgaaattgatttaatcgtggaaacaaattttgatttttcaggaaaagacgaattagatgaaactttgtcttatgttgatttctatgaggcaacaaaagcagttgtagaatcttcaaaagctgatttaattgaacatgttgcctttgaaattattcaagcagtaaaggctacttcagagcgtatatcaacggttgaagtccatcttagaaaattagccgtaccgattgaaggaatttttgattcagctgaaatcgagatgagagggtaataa BBa_S04032_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgtacaaaataaaacttaataatatgaaatttagagcacatattggtgttctgccagaagaaaaagttctcggacaaaatctcgaaattgatttaatcgtggaaacaaattttgatttttcaggaaaagacgaattagatgaaactttgtcttatgttgatttctatgaggcaacaaaagcagttgtagaatcttcaaaagctgatttaattgaacatgttgcctttgaaattattcaagcagtaaaggctacttcagagcgtatatcaacggttgaagtccatcttagaaaattagccgtaccgattgaaggaatttttgattcagctgaaatcgagatgagagggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z