BBa_K137010 1 fimE IRL fimE IRL 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat left recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963843 1 IRL in range1963843 1 1 17 annotation1963844 1 IRL out range1963844 1 19 35 BBa_S04043 1 BBa_S04043 K137070:B0010 2008-08-07T11:00:00Z 2015-05-08T01:14:34Z true false _187_ 0 3112 9 Discontinued false false Allen Lin component1970339 1 BBa_B0010 component1970335 1 BBa_K137010 component1970338 1 BBa_K137008 annotation1970335 1 BBa_K137010 range1970335 1 1 35 annotation1970339 1 BBa_B0010 range1970339 1 87 166 annotation1970338 1 BBa_K137008 range1970338 1 44 78 BBa_K137008 1 IRR fimE IRR 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat right recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963842 1 IRR in range1963842 1 19 35 annotation1963841 1 IRR out range1963841 1 1 17 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K137010_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatt BBa_S04043_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatttactagagaagatgaaacatttggggccaaactgtccatattatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K137008_sequence 1 aagatgaaacatttggggccaaactgtccatatta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z